Abstract
The increasing abuse of antimicrobials worldwide has led to a rise in the rates of antimicrobial resistance, as steady, low doses have lead to surges of micro-organisms that have developed antimicrobial resistant mutations. Thus, this paper seeks to review an alternative pathway to curing microbial infections: gene editing via lipid nanoparticles. By using lipid nanoparticles to target and neutralize the bacteria Mannheimia Haemolytica in cattle, we can avoid the excessive and pre-emptive use of antimicrobials such as the drug tetracycline that result in the development of antimicrobial resistant pathogens. The lipid nanoparticles can be used to transport guide-RNA and CRISRP-Cas9 for a knockout effect. The CRISPR-Cas9 system should be enveloped in a layer of lipids using a microfluidics mixer. These lipids and substances will include: phospholipids, ionizable cationic lipids, cholesterol, poly(ethylene glycol)-conjugated (PEGylated) lipids (green), LBP, c4b binding proteins, PEG-lipids (including the variants: PEG-CHMC, CHEMS, and CHST) and substances that aid with structure and targeting. Our results present precedent for the use of lipid nanoparticles to treat antimicrobial-resistant bacteria, showing that further research is recommendable.
Introduction
Antimicrobial agents function by targeting essential metabolic processes, such as enzyme activity, that are essential to the survival and growth of bacteria. However, some bacteria can develop random genetic mutations that alter their metabolic processes or provide other advantages against antimicrobial agents. This phenomenon, known as antimicrobial resistance (AMR), allows these bacteria to survive and proliferate even in the presence of antimicrobials. When bacteria develop AMR through mutations, they can reproduce rapidly, creating entire colonies of resistant bacteria. These resistant bacteria can further spread their AMR genes to non-mutant bacteria through a process known as horizontal gene transfer, amplifying the resistance problem.

Created in BioRender. Abreu, D. (2024) https://BioRender.com/s00r448
AMR is driven by several factors, including the unrestrained use of antimicrobials in humans and livestock, the preemptive use of antimicrobials in animals to prevent disease or promote growth, poor water quality and hygiene, inadequate infection control, and inappropriate food handling. Though these practices have been banned by the European Union and by the U.S FDA, many developing countries such as China, India and many African countries still openly use antibiotics as livestock feed additives to encourage growth in their economies (24). These practices overexpose bacteria to antimicrobials or increase the need for their use, providing bacteria with frequent low doses that encourage the development of resistance. Consequently, resistant bacteria become dominant, having less selective pressure from antibiotics applied to them compared to non-resistant strains. According to the World Health Organization, antimicrobial resistance was responsible for over 1.27 million human deaths globally in 2019, a figure that is expected to rise if no action is taken (( World Health Organization. Antimicrobial resistance. World Health Organization. (2023, November 21).)). If the AMR crisis continues unchecked, we risk returning to an era where child mortality is much more common.
This paper focuses on combating AMR in Mannheimia haemolytica, a gram-negative coccobacillus responsible for causing Bovine Respiratory Disease (( (BRD) C.L. Klima, T.W. Alexander, S. Hendrick, T.A. McAllister, Characterization of Mannheimia haemolytica isolated from feedlot cattle that were healthy or treated for bovine respiratory disease. Can J Vet Res. 78(1), 38-45 (2014).))’ (( ScienceDirect. Mannheimia haemolytica. Mannheimia Haemolytica – an overview).)), the leading cause of mortality in cattle across all age groups “except young calves” (( MSD Animal Health Republic of Ireland. Bovine respiratory disease. MSD Animal Health Republic of Ireland. (2022, August 23).)). Cattle infected with BRD exhibit a range of symptoms, including high fever, difficulty breathing, rapid and shallow breathing, and coughing (( J. Campbell, M. Jelinski, Bovine respiratory disease. Beef Research).)). The economic impact of BRD is significant, with estimated losses in the United States alone ranging from $800 million to $900 million annually (( K.R. Brooks, K.C. Raper, C.E. Ward, B.P. Holland, C.R. Krehbiel, D.L. Step, Economic effects of bovine respiratory disease on feedlot cattle during backgrounding and finishing phases. Oklahoma State University Extension Fact Sheet)). To prevent infection, farmers often incorporate antimicrobials such as tetracycline into livestock feed (( (BRD) C.L. Klima, T.W. Alexander, S. Hendrick, T.A. McAllister, Characterization of Mannheimia haemolytica isolated from feedlot cattle that were healthy or treated for bovine respiratory disease. Can J Vet Res. 78(1), 38-45 (2014).)). However, the constant low doses of these drugs, combined with unhygienic and overcrowded living conditions, increase the likelihood of Mannheimia haemolytica developing resistance. Studies have shown that 18% of Mannheimia haemolytica isolates contain genes conferring resistance to tetracycline, with the bacteria also beginning to develop resistance to other antimicrobials used to treat BRD (( D. Bitounis, M.M. Amiji, Lipid nanoparticles target haematopoietic stem cells. Nat. Nanotechnol. (2024)).

Created in BioRender. Abreu, D. (2024) https://BioRender.com/s00r448
A potential alternative to antibiotics to treat Mannheimia Haemolytica are vaccines, which use either weakened versions of the bacteria, antigens, or other cell components/products to elicit a primary immune response that helps memory cells contribute to a secondary response. A review was conducted by Sarah F. Capik et al which looked into the vaccine efficacy of multiple bovine respiratory disease-causing pathogens including Mannheimia Haemolytica. Several potential vaccine formulations were identified, including vaccines that introduce “genetically attenuated M. haemolytica leukotoxin,” “bacterial extracts of… M. haemolytica” and “bacterial extract of M. haemolytica A1.” (( S. F. Capik, H. K. Moberly, R. L. Larson, Systematic review of vaccine efficacy against Mannheimia haemolytica. Ksubci. 55, (2021) )). Available from: https://ksubci.org/wp-content/uploads/2024/03/Bov-Pract_55_2021_Systematic-review-vax_Capik.pdf.) However, two of the studies that the review included found no significant decreases in BRD-related morbidity and mortality. Another study reviewed found that vaccines carrying leukotoxin found a decrease in morbidity of the disease, but no significant decrease in mortality or “lung lesions.” Ultimately, the review article concluded that “sufficient similarities [between results of each study] did not exist to create a summary recommendation regarding the evidence for BRD bacterial vaccine efficacy in beef or dairy calves.” (( S. F. Capik, H. K. Moberly, R. L. Larson, Systematic review of vaccine efficacy against Mannheimia haemolytica. Ksubci. 55, (2021). Available from: https://ksubci.org/wp-content/uploads/2024/03/Bov-Pract_55_2021_Systematic-review-vax_Capik.pdf.)) Other researchers, such as Muhammad S. Uddin et al, have proposed factors that may contribute to the vaccines’ lack of consistent effect (( M. S. Uddin, J. O. Guluarte, D. W. Abbott, et al., Development of a spore-based mucosal vaccine against the bovine respiratory pathogen Mannheimia haemolytica. Sci Rep. 13, 12981 (2023). https://doi.org/10.1038/s41598-023-29732-4.)). These factors include “timing of vaccination, antigen combinations, stress factors, and levels of maternal antibodies.” (( M. S. Uddin, J. O. Guluarte, D. W. Abbott, et al., Development of a spore-based mucosal vaccine against the bovine respiratory pathogen Mannheimia haemolytica. Sci Rep. 13, 12981 (2023). https://doi.org/10.1038/s41598-023-29732-4.)) However, it was hypothesized that the most significant factor is the delivery of the vaccine, which is typically intramuscular. Intramuscular injection of vaccines aims for a systematic immune response. However, a delivery of drugs or a vaccine through the respiratory system is likely to be much more efficient as both a systematic and a mucosal immune response are triggered, further increasing protection at the site of infection (( M. S. Uddin, J. O. Guluarte, D. W. Abbott, et al., Development of a spore-based mucosal vaccine against the bovine respiratory pathogen Mannheimia haemolytica. Sci Rep. 13, 12981 (2023). https://doi.org/10.1038/s41598-023-29732-4.))
Another potential treatment for Mannheimia Haemolytica could be probiotics. Research into the effects of probiotics on Mannheimia Haemolytica is limited. However, a study by S. Amat et al (( S. Amat, E. Timsit, D. Baines, J. Yanke, T. W. Alexander, Development of bacterial therapeutics against the bovine respiratory pathogen Mannheimia haemolytica. Appl Environ Microbiol. 85, e01359-19 (2019). https://doi.org/10.1128/AEM.01359-19.)) conducted in vitro found that bacteria of the family Lactobacillus could inhibit Mannheimia Haemolytica. The study extracted different strains of intranasal bacteria from healthy cattle, and then exposed the strains to colonies of Mannheimia Haemytica. The experiment found 6 strains of Lactobacillus in particular that could be effective against the bacteria, and found that each strain had inhibited the adherence of Mannheimia Haemolytica to Bovine Turbinate cells by 32% to 78%. It was also found that the Lactobacillus isolates could upregulate the expression of interleukin-8 and interleukin-6. Upregulated expression of interleukin-8 can be effective in boosting the immune system against Mannheimia Haemolytica, as IL-8 is a ‘chemoattractant cytokine’ that ‘activates neutrophils in inflammatory regions (( M. Bickel, The role of interleukin-8 in inflammation and mechanisms of regulation. J Periodontol. 64, 456-460 (1993). PMID: 8315568.)) Activation of neutrophils makes it more likely that a successful immune response will eliminate or contain a Mannheimia Haemolytica infection. Meanwhile, IL-6 can invoke an inflammatory response and is involved in the signaling pathways of the general immune response (( T. Tanaka, M. Narazaki, T. Kishimoto, IL-6 in inflammation, immunity, and disease. Cold Spring Harb Perspect Biol. 6, a016295 (2014). doi: 10.1101/cshperspect.a016295.)). Most significantly, the strains’ production of lactic acid was investigated as an inhibitor of Mannheimia Haemolytica. The investigation found that M. Haemolytica could be inhibited at lactic acid concentrations of 18.75 to 150mM and found that the Lactobacillus strains could form supernatants with lactic acid concentrations ranging from 80 to 142mM. Thus, it is plausible to think that probiotics could be effective in the treatment of Mannheimia Haemolytica. However, the 6 Lactobacillus strains investigated by these researchers were already pre-existing in healthy cattle, suggesting that, while the Lactobacillus may aid in inhibiting Mannheimia Haemolytica and promoting an immune response, the probiotics themselves are not sufficient to treat the bacterial infection alone. The study does not make mention of what strategies, such as genetic editing of the Lactobacillus, could be used to turn these findings into an effective treatment.
In response to this challenge, the emergence of nanotechnology offers promising new approaches for disease therapeutics, including combating AMR. Nanoparticles, which range in size from approximately 1 to 200 nanometers (( A. Wadhwa, T.R. Bobak, L. Bohrmann, R. Geczy, S. Sekar, G. Sathyanarayanan, J.P. Kutter, H. Franzyk, C. Foged, K. Saatchi, U.O. Häfeli, Pulmonary delivery of siRNA-loaded lipid-polymer hybrid nanoparticles: Effect of nanoparticle size. OpenNano. 13, 100180 (2023).))’ (( N. Joudeh, D. Linke, Nanoparticle classification, physicochemical properties, characterization, and applications: a comprehensive review for biologists. J Nanobiotechnol. 20, 262 (2022)), can be composed of various materials, including “proteins, carbohydrates, lipids”, and other biomolecules (( N. Joudeh, D. Linke, Nanoparticle classification, physicochemical properties, characterization, and applications: a comprehensive review for biologists. J Nanobiotechnol. 20, 262 (2022)). Among these, organic nanoparticles are particularly versatile, as their composition can be adjusted to achieve desirable properties (( N. Joudeh, D. Linke, Nanoparticle classification, physicochemical properties, characterization, and applications: a comprehensive review for biologists. J Nanobiotechnol. 20, 262 (2022)). Lipid nanoparticles, a type of organic nanoparticle, can be useful for encapsulating and delivering therapeutic payloads, such as RNA or proteins. These nanoparticles consist of multiple lipid layers that protect the payload and facilitate its delivery to specific target cells. The inner layer of lipids consist of ionizable cationic lipids, which serve to encapsulate the RNA and also trigger endosomal escape. Ionizable cationic lipids are neutrally charged in neutral pH environments. However, upon reaching an acidic environment, namely the endosome which is a vesicle used for endocytosis in cells, the ionizable cationic lipid becomes positively charged. The positive charge destabilizes the endosomal membrane, enabling the contents of the LNP, the CRISPR formulation, to interact with the cell’s DNA. (( Let’s talk about lipid nanoparticles. Nat Rev Mater. 6, 99 (2021)) Then, there is an outer layer of phospholipids (cationic lipids and PEGylated lipid) to protect the inner layer. The PEGylated lipids (contain PEG compound) prevent nanoparticles from clumping together and keeps the nanoparticle dissolved, while also protecting the nanoparticle from immune system cells. Throughout the nanoparticle, there is also cholesterol that gives strength and structure to the particle. These lipid layers protect and contain the payload (( Aizaz, YouTube. Lipid nanoparticles – how do they work – structure of LNPs – LNPs in mRNA vaccine Pfizer/Moderna. (2021, February 11)).
Certain lipids that are part of the nanoparticle are used for cell targeting. These lipids are able to bond to specific ligands or chemical groups that are unique to the target cell. Because these lipids form unique bonds, they cannot bond to non-target cells that do not contain the target compound. Once the nanoparticle is bound to the target cell, it is taken up by the cell via “endocytosis,” and “the ionizability of the lipids at low pH enables endosomal escape, which allows release of the cargo into the cytoplasm.” (( Let’s talk about lipid nanoparticles. Nat Rev Mater. 6, 99 (2021)). Other factors, such as size and acidity, also play a part in the targeting of nanoparticles (( Let’s talk about lipid nanoparticles. Nat Rev Mater. 6, 99 (2021)). Lipid nanoparticles play many important roles in the delivery of medicinal payloads within the body: The outer layer of lipids provides protection to the payload so that other substances do not break it down or absorb it. Certain lipids and other substances (like proteins, receptors, ligands) on the surface of the nanoparticle also ensure that the payload will be delivered to target cells only.
Lipid nanoparticles are particularly promising for delivering CRISPR-Cas9 systems, a revolutionary tool in genome engineering. CRISPR-Cas9 was first discovered in archaea and bacteria and stands for “Clustered Regularly Interspaced Short Palindromic Repeats” (( F. Zhang, Questions and answers about CRISPR. In: @broadinstitute. (2014)). These are segments of the bacteria’s DNA composed of repetitive ‘repeats’ and ‘spacers.’ The ‘repeats’ are sequences of DNA that are all the same, while ‘spacers’ are remnant DNA sequences from past viral infections. Whenever a new viral infection occurs within the bacteria, a new spacer is created that matches the DNA sequence of the virus. Attached to the CRISPR sequences are three other components: the crRNA (CRISPR RNA), the tracrRNA and the Cas9 protein. The crRNA and tracrRNA are similar to the spacer sequences and can bind to the DNA of a bacteriophage that has previously attacked the bacteria. When the tracrRNA finds something called a ‘PAM’ site (a short sequence of DNA that helps to target the desired sequence), the Cas9 will create a cut in the phage DNA, thus preventing it from reproducing in the bacteria. Even though this phenomenon was discovered in archaea and bacteria, humans are able to harness this method to create specific changes in DNA. Rather than use tracrRNA and crRNA, a combination has been engineered called guide RNA (or gRNA). The gRNA is made complimentary to a target sequence of DNA, then the Cas9 protein can make a cut in the DNA. However, we can also add template DNA to the system. This allows cells to use the desired/corrected DNA sequences to repair the cuts made by the CRISPR system. This system allows precise editing of DNA sequences, making it a powerful tool for disrupting the genes responsible for AMR in bacteria (( F. Zhang, Questions and answers about CRISPR. In: @broadinstitute. (2014)).
Lipid nanoparticles can be engineered to target Mannheimia haemolytica cells in cattle and deliver a CRISPR-Cas9 system containing guide RNA (gRNA) that is complementary to the bacterium’s DNA transcription genes. By disrupting these genes, the CRISPR-Cas9 system can disable the bacterium’s ability to produce essential proteins or resistance genes such as the tetracycline resistance genes tetM, effectively restoring the bacterium’s susceptibility to antibiotics. While the use of lipid nanoparticles for delivering CRISPR-Cas9 is still under development, early studies show promising results. For instance, Miller et al. (2017) synthesized zwitterion amino lipids capable of delivering Cas9 mRNA and sgRNA to target cells, achieving a 95% reduction in the target protein (( J.B. Miller, S. Zhang, P. Kos, H. Xiong, K. Zhou, S.S. Perelman, H. Zhu, D.J. Siegwart, Non-Viral CRISPR/Cas Gene Editing In Vitro and In Vivo Enabled by Synthetic Nanoparticle Co-Delivery of Cas9 mRNA and sgRNA. Angew Chem Int Ed Engl. 56(4), 1059-1063 (2017)). Another study by Guo et al. (2019) developed a “nanolipogel” system that delivered CRISPR-Cas9 to breast cancer cells, resulting in an 81% knockout of the target gene and a 77% reduction in tumor size (( P. Guo, J. Yang, J. Huang, D.T. Auguste, M.A. Moses, Therapeutic genome editing of triple-negative breast tumors using a noncationic and deformable nanolipogel. Proc Natl Acad Sci U S A. 116(37), 18295-18303 (2019)).
The application of nanoparticles in therapeutics has shown promise in various areas, such as the treatment of Sickle Cell Disease (SCD), a genetic disorder caused by a mutation in the beta-globin gene (( National Center for Biotechnology Information (US). Genes and Disease [Internet]. Bethesda (MD): National Center for Biotechnology Information (US); 1998-. Anemia, sickle cell)), leading to the production of abnormal hemoglobin and sickled red blood cells. Traditional gene therapies for SCD are ex vivo, requiring complex procedures like chemotherapy and specialized lab facilities. However, these methods pose significant challenges, making in vivo treatments more desirable. The main obstacle to in vivo gene therapy is the difficulty in accurately targeting the correct cells, which can lead to off-target effects, including other genetic disorders and cancers. Recent advancements have focused on developing lipid nanoparticles (LNPs) to deliver gene-editing tools directly to haematopoietic stem cells in vivo (( D. Bitounis, M.M. Amiji, Lipid nanoparticles target haematopoietic stem cells. Nat. Nanotechnol. (2024)). These LNPs are composed of various lipids, such as N-hydroxy succinimide esters, pyridyl disulfides, and aldehydes, in addition to common lipids like phospholipids, ionizable lipids, cholesterol, and PEGylated lipids (( D. Bitounis, M.M. Amiji, Lipid nanoparticles target haematopoietic stem cells. Nat. Nanotechnol. (2024)). These components allow the nanoparticles to specifically bind to unique amino and carboxylic acids on the target cells, ensuring precise delivery of the gene-editing payload.

By drawing parallels from the SCD treatment, specific lipids that bond to unique compounds in target cells can be identified and used to develop nanoparticles for combating antimicrobial resistance in BRD. In summary, this paper proposes using lipid nanoparticles to encapsulate, protect, and deliver a CRISPR-Cas9 system to Mannheimia haemolytica cells in the pulmonary system of cattle. By targeting and disabling the genes responsible for the bacterium’s survival and resistance, this approach aims to combat the growing problem of AMR in BRD, reducing its impact on both animal health and the agricultural economy.

Methodology
Search Strategy
To find the most appropriate articles and other sources, several keywords were utilized. These included: “CRISPR”, “Lipid Nanoparticles / LNPs”, “Efficiency”, “Bovine”, “AMR / Anti-Microbial Resistance”, and “Targeting.” A filter was not used, but sources were manually accepted for use if they were in an article format (with the exception of a video that was accepted due to its useful explanation and its academic background).
Inclusion Criteria
This review article aims to primarily utilize peer-reviewed scientific journals and databases to source information. An example of a database that has been used repeatedly is the National Library of Medicine – National Center for Biotechnology Information, which uses an in-depth ‘reviewer’ system, involving the collaboration of professionals such as PhD graduates and professors, to edit manuscripts to be refined and accurate. Other sources used also have peer-review systems with reviewers from academia or industry positions. The use of peer-review systems guarantees that information used in this article is agreed upon by consensus of the scientific community. Another source of information is from biotechnology companies. Data from company websites, such as data on the ideal zeta potential of lipid nanoparticles from Inside Therapeutics, was useful in providing practical data that would create a synthesis of information more likely to be readily applicable in the workplace rather than only replicable under unfavorable conditions in a laboratory setting. There are two main categories of sources: human sciences oriented and biology oriented, with biology oriented sources forming a large majority. Human science sources, such as information from the World Health Organization, were mainly used to provide background information and emphasize the importance of the topic, while biology-oriented sources were used to explain biotechnological processes and concepts that can be used to create a valuable synthesis aimed at alleviating the wider problem. Many of the conclusions about lipid nanoparticles reached in the article must be in context for use in CRISPR systems, as the process requires certain specific conditions such as size and shape.
Due to the specific nature of the research article, the general rule for including sources was that they be published in the 21st century (this comes with the exception of the Sickle Cell Anemia article on the National Center for Biotechnology Information. This exception has been permitted due to the included information’s consistency with modern scientific consensus). CRISPR is quite a modern technology so the depreciation of information’s validity, due to the increased reliability of modern research and the still shallow understanding of CRISPR, is limited. Research articles were chosen based on the existence of a peer-review system. Articles must either fall into one of two categories: human impact and biological understanding. Data gathered on the background information of CRISPR-Cas9 and lipid nanoparticles was open to any species, namely human. However, data regarding the targeting systems of the lipid nanoparticles must be specific to the bacteria Mannheimia Haemolytica.
Data Extraction and Synthesis Method
Data that was collected was then sub-categorized into one of the following: nanoparticle bond targeting, nanoparticle size/shape dependent bonding, nanoparticle synthesis, challenges in synthesis, gRNA design, nanoparticle delivery, and CRISPR-Cas9. Each sub-category will systematically form part of the overarching conclusion, arranged in a list format, that explains how lipid nanoparticles can be specified to target Mannheimia Haemolytica in cattle. This will form a narrative synthesis, where text is utilized to streamline several sources into one logical synthesis. The genomic data for Mannheimia Haemolytica, which can be found in the National Center for Biotechnology Information, was then analyzed to find suitable genes that would either disrupt the bacteria’s resistance genes or disrupt the bacteria’s replication processes, leading to neutralization. The chosen gene was ultimately processed through the bioinformatics software ‘Synthego,’ which provided a list of guide-RNAs in order of predicted on-target score and off-target effects.
Literature Review
Production of Lipid Nanoparticles:
Lipid nanoparticles are synthesized using a microfluidics mixer that facilitates the precise and consistent production of nanoparticles. Firstly, RNA and a buffer solution are mixed with lipid components and water-miscible solvent (water-miscible solvent is any solvent which forms a homogenous mixture). The microfluidics mixer continuously aggregates the contents added. In the mixture, the positively charged lipids interact with the negatively charged RNA and form multiple lipid layers that encapsulate the RNA Different types of lipids will form different layers over the RNA, completely encapsulating it and creating layers of stability and make the nanoparticle more robust for drug delivery (( A. Wadhwa, T.R. Bobak, L. Bohrmann, R. Geczy, S. Sekar, G. Sathyanarayanan, J.P. Kutter, H. Franzyk, C. Foged, K. Saatchi, U.O. Häfeli, Pulmonary delivery of siRNA-loaded lipid-polymer hybrid nanoparticles: Effect of nanoparticle size. OpenNano. 13, 100180 (2023).)). The use of a thiol-ene polymer microfluidics chip can alaso effectively mitigate solvent-induced material degradation and ensure integrity of the nanoparticles during storage and delivery. (( A. Wadhwa, T.R. Bobak, L. Bohrmann, R. Geczy, S. Sekar, G. Sathyanarayanan, J.P. Kutter, H. Franzyk, C. Foged, K. Saatchi, U.O. Häfeli, Pulmonary delivery of siRNA-loaded lipid-polymer hybrid nanoparticles: Effect of nanoparticle size. OpenNano. 13, 100180 (2023).)). According to the researchers behind the creation of the thiol-ene chip, “this material displays superior chemical compatibility with most organic solvents, while being rigid, which allows for manufacturing with high flow rates (and consequently high pressure). Also, this material provides low small-molecule permeability, and thus possesses features particularly suited for the production of LPNs (lipid-polymer nanoparticles).” (( A. Wadhwa, T.R. Bobak, L. Bohrmann, R. Geczy, S. Sekar, G. Sathyanarayanan, J.P. Kutter, H. Franzyk, C. Foged, K. Saatchi, U.O. Häfeli, Pulmonary delivery of siRNA-loaded lipid-polymer hybrid nanoparticles: Effect of nanoparticle size. OpenNano. 13, 100180 (2023).)). The thiol-ene polymer microfluidics chip was used alongside a “sodium acetate buffer (125 mM, pH ∼5.2).” Sodium acetate has been used before in the creation of siRNA-LNPs, suggesting that sodium acetate could be a reliable buffer solution for the creation of CRISPR-carrying LNPs. However, this claim must be investigated in a laboratory setting to find the most ideal buffer solution.
Inside Therapeutics also outlines the insertion of targeting ligands, stating: ‘they are coated with a lipid with a functional group, which is then put in contact and binds with a targeting ligand. This has the advantage of having the ligands only located on the surface of the LNP but requires a more complex synthesis process.’ Details on the specific lipid/functional group needed are to be determined, as c4b and LBP are novel targeting substances. Research in laboratories must be conducted.

Challenges in Nanoparticle Synthesis:
Though beneficial for in vivo gene editing, there are many issues faced during LNP synthesis. One factor to consider is the nanoparticle’s aggregation. Aggregation is when individual nanoparticles clump together and form large clusters. According to Inside Therapeutics, a biotechnology company, aggregation comes because of an imbalance in the nanoparticle’s ‘Zeta potential,’ meaning the electrostatic force on the surface of the particle (( A complete guide to understanding lipid nanoparticles (LNP). Inside Therapeutics. (2024)). Imbalance can happen if the nanoparticles are too neutral, where they will not repel each other through like-charges, or too charged, causing toxicity. Aggregation can cause the nanoparticle to lose stability and decrease the nanoparticle’s lifespan. It can also lead to great reductions in efficiency, where the dosages may become imbalanced if certain tissues have larger nanoparticle clusters or the clusters will become less likely to be taken up by cells (( A complete guide to understanding lipid nanoparticles (LNP). Inside Therapeutics. (2024)). Inside Therapeutics has deemed that ‘-30 mV is generally considered optimal.’ This charge can be achieved is by shifting the concentration of ionizable lipids or shifting the pH (( A complete guide to understanding lipid nanoparticles (LNP). Inside Therapeutics. (2024)). Another challenge when synthesizing lipid nanoparticles is maintaining the particles’ stability (ensuring the components function and stay connected). Many of the body’s natural functions may interfere with the stability of lipid nanoparticles. An example would be the hydrolases in the body, which could catalyze hydrolysis reactions with water and lipids, causing them to break down. The lipids may also become oxidized. Environmental factors also play a role in the degradation of lipid nanoparticles, such as improper lipid composition, overexposure to light and overexposure to high temperatures. Therefore, it is important to make changes to the nanoparticles and the way they are stored to ensure stability. Antioxidants such as Vitamin E can be added to the formulation, and lipids such as cholesterol will protect the nanoparticle’s original structure by adding rigidity (( K. Hashiba, M. Taguchi, S. Sakamoto et al., Overcoming thermostability challenges in mRNA–lipid nanoparticle systems with piperidine-based ionizable lipids. Commun Biol. 7, 556 (2024)). Practical data would need to be gathered to know the exact quantity of Vitamin E and cholesterol required. The nanoparticles should also be stored in low-light, inert gas conditions to delay decomposition.
CRISPR Delivery Efficiency:
The two principle avenues of gene editing are ex vivo and in vivo, each with their own advantages and disadvantages. Ex vivo gene editing is most effective when target cells are easy to harvest, either by being present in blood vessels (T-cells, hematopoietic cells, etc) or on external organs such as the eye (( A. Macarrón Palacios, P. Korus, B. G. C. Wilkens, N. Heshmatpour, S. R. Patnaik, Revolutionizing in vivo therapy with CRISPR/Cas genome editing: breakthroughs, opportunities and challenges. Front Genome Ed. 6, 1342193 (2024). doi: 10.3389/fgeed.2024.1342193.)). Target cells that are easy to harvest can quickly be edited and reproduced to produce a large quantity of gene-edited cells ready to be introduced to the body. Ex vivo gene editing also has the benefit of being conducted in a laboratory, where methods such as electroporation (the application of an electrical field to cells to increase membrane permeability, allowing CRISPR-Cas9 to enter the cell (( S. Karim, S. W. Adamson, RNA interference in ticks: a functional genomics tool for the study of physiology. AdvInsectPhysiol. 42,(2012). https://www.sciencedirect.com/science/article/abs/pii/B9780123876805000045.)) increase on-target effect, and cells can be monitored for off-target effects. Thus, ex vivo gene editing is likely to have greater effect and a lower risk of side-effects. However, under the circumstances of gene editing cattle to treat a bacterial infection of the lungs, in vivo gene editing is preferable due to the following reasons; ex vivo gene editing is less effective when target cells are found in the lungs (( R. S. Soofiyani, B. Baradaran, F. Lotfipour, T. Kazemi, L. Mohammadnejad, Gene therapy, early promises, subsequent problems, and recent breakthroughs. Adv Pharm Bull. 3, 249-255 (2013). doi: 10.5681/apb.2013.041.)), as they are more difficult to harvest, whereas in vivo gene editing can deliver gene editing systems directly via inhalation or injection; in vivo gene editing can be distributed in the form of aerosolized canisters or vaccines rather than requiring the presence of a lab, making distribution to lower income countries, which are often the site of anti-microbial abuse, cheaper and easier; in vivo gene editing, unlike ex vivo editing, does not require chemotherapy to remove unedited cells, lowering costs and the amount of time-consumed in the process. Though, in this circumstance, in vivo gene editing is the most optimal method, it is also quite risky, as the lack of laboratory oversight means a lower likelihood of CRISPR-Cas9 systems being taken up by cells. There also comes the issue of biodistribution, where lipid nanoparticles can be transported by the blood to other parts of the body and can cause off-target effects. A particular issue in biodistribution is the liver. The liver serves to detoxify small molecules. To carry out this role, it must be highly accessible to small molecules, meaning lipid nanoparticles are highly likely to accumulate in the liver instead of their target organ, nullifying the potential for gene editing (( R. C. Wilson, L. A. Gilbert, The promise and challenge of in vivo delivery for genome therapeutics. ACS Chem Biol. 13, 376-382 (2018). doi: 10.1021/acschembio.7b00680.)). LNP delivery methods such as inhalation must be explored to overcome the issue. Another major issue is the possibility of off-target effects. The gRNA of the CRISPR-Cas9 system, when delivered in vivo, can bind to the same sequence but on a non-target cell. This sequence could either form part of a non-coding DNA region or a gene that codes for a protein. Should the sequence code for a protein, it can cause harmful mutations to the cell, leading to a loss of function, death, or transformation into a cancerous cell (( A. Macarrón Palacios, P. Korus, B. G. C. Wilkens, N. Heshmatpour, S. R. Patnaik, Revolutionizing in vivo therapy with CRISPR/Cas genome editing: breakthroughs, opportunities and challenges. Front Genome Ed. 6, 1342193 (2024). doi: 10.3389/fgeed.2024.1342193.)).
Therefore, it is important that In Vivo gene therapy be designed in the safest and most precise manner possible. One way to ensure delivery efficiency is to create a targeting mechanism for the lipid nanoparticles. The lipid nanoparticles must be manufactured to contain surface proteins, ligands, receptors or other targeting substance. These targeting proteins must be complementary to surface proteins found on the bacteria Mannheimia Haemolytica (( L. Duan, K. Ouyang, X. Xu, L. Xu, C. Wen, X. Zhou, Z. Qin, Z. Xu, W. Sun, Y. Liang, Nanoparticle Delivery of CRISPR/Cas9 for Genome Editing. Front Genet. 12, 673286 (2021)). An example of a potential targeting substance is c4b binding protein. This way, the lipid nanoparticles will only bind to and be absorbed by the target bacteria cells. Another way to increase delivery efficiency is the means of delivering the lipid nanoparticles themselves. The ideal method would be to have the nanoparticles inhaled by the cattle, which would transport the lipid nanoparticles to the pulmonary system, which is the site of Bovine Respiratory Disease ((ScienceDirect. Mannheimia haemolytica. Mannheimia Haemolytica – an overview).)). Lipid Nanoparticles that are inhaled have already been designed and approved before, namely Arikayce® (used for treating mycobacterium in humans (( E.W.X. Leong, R. Ge, “Lipid Nanoparticles as Delivery Vehicles for Inhaled Therapeutics,” Biomedicines. 10(9), 2179 (2022)).). Research has found that a particular ionizable lipid, SM-102, has the most desirable physical and chemical properties that favor proper aerosolization while maintaining stability (( M.M. Lewis, M.R. Soto, E.Y. Maier, et al., Lipid Nanoparticles: A Novel Approach for Antimicrobial Delivery. Int J Nanomedicine. 16, 427-451 (2021)). Studies also find that the percentage content of PEG lipids and cholesterol within the particles can contribute to more successful aerosolization that prevents breakage of nanoparticles, where 1.5%mol has been found to be the ideal concentration of PEG lipids (( M. Ongun, “Lipid nanoparticles for local delivery of mRNA to the respiratory tract: Effect of PEG-lipid content and administration route,” Eur. J. Pharm. Biopharm. (2024)). However, the field of aerosolization requires more development. There are also complications that could arise during delivery via inhalation as the LNPs interact with the pulmonary system and immune responses of cattle. A thesis was presented by L. Bassel et al (( L. L. Bassel, E. I. Kaufman, S.-N. A. Alsop, J. Buchan, J. Hewson, E. E. McCandless, R. Tiwari, S. Sharif, K. Vulikh, J. L. Caswell, Effect of aerosolized bacterial lysate on development of naturally occurring respiratory disease in beef calves. J Vet Intern Med. 35, (2021). Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC7848379.)) that looked into ‘the effect of aerosolized bacterial lysate on the development of pneumonia in cattle.’ In this thesis, the anatomic defenses and clearance of particles in cattle was explained. The airways of cattle are lined with ciliated epithelial cells. These respiratory epithelial cells secrete mucus that entraps particulates, which could include lipid nanoparticles, and use cilia for ‘ mucociliary clearance’ where the particulates are removed from the lungs and moved towards the oral cavity. The mucus involved is estimated to be composed of ‘98% water and 2% solids,’ where Mucin, a large molecule made of glycoproteins that binds to particles, makes up a large majority of the 2%. Solutions to this problem have already been categorized by teams of researchers such as X. Yan and X. Sha. Their article on ‘nanoparticle-mediated strategies for enhanced drug penetration and retention in the Airway mucosa’ delves specifically into the strategies for lipid nanoparticle delivery into the pulmonary system (( X. Yan, X. Sha, Nanoparticle-mediated strategies for enhanced drug penetration and retention in the airway mucosa. MDPI Pharmaceutics. 15, 2457 (2023). Available from: https://www.mdpi.com/1999-4923/15/10/2457 )). The principle strategy to boost mucosal penetration and retention of phospholipid complexes was to add ‘self-nano emulsification systems’ alongside the phospholipid complex. The self-nano emulsification system is comprised of water, oil, and surfactant in unspecified ratios. This creates droplets of 100-200nm that have hydrophobic surfaces and surround the phospholipid complexes and, thus, decrease interaction with mucus mucin as mucus’ high composition of water repels the hydrophobic self-nano emulsification systems. This could increase the rate of successful drug delivery of the CRISPR systems. (( X. Yan, X. Sha, Nanoparticle-mediated strategies for enhanced drug penetration and retention in the airway mucosa. MDPI Pharmaceutics. 15, 2457 (2023). Available from: https://www.mdpi.com/1999-4923/15/10/2457 )). Other than mucosal clearance, the issue of an immune response also threatens the delivery efficiency of the LNPs. Because the lipid nanoparticles are foreign substances to a cattle’s body, immune cells can absorb the LNPs or produce antibodies, such as PEG-targeting antibodies, that can break-down the LNP and prevent successful gene editing. Several solutions to immune responses are discussed in the Discussions section that address the issue, such as the use of c4b binding protein and the use of special PEG-Cholesterol lipids. The final issue that may present itself is that, even if the lipid nanoparticles are successfully absorbed by the bacterium, the CRISPR-Cas9 system may create an off-target effect, meaning it cuts the incorrect segment of DNA. In order to reduce the risk of off-target effects, a bioinformatics software can be used that compares potential guide RNA sequences to the entire genome of the organism. Subsequently, the guide RNA with the lowest predicted off-target effect percentage can be chosen. These types of software are not completely accurate, but provide a valid risk assessment. Another way of decreasing the risk of off-target effects is to use a modified variant of the Cas9 protein. According to a review by Congting Guo et al (( C. Guo, X. Ma, F. Gao, Y. Guo, Off-target effects in CRISPR/Cas9 gene editing. Front. Bioeng. Biotechnol. 11, 1143157 (2023)), the most effective modified variant of Cas9 in terms of reducing off-target effects is evoCas9. In a study, it was found that evoCas9 saw a reduction in off-target effects of 98.7%. EvoCas9 was discovered by screening for random mutations in the REC3 domain in SpCas9 variants. Th REC3 domain has the ability to improve gene editing accuracy (( A. Casini, M. Olivieri, G. Petris, C. Montagna, G. Reginato, G. Maule, F. Lorenzin, D. Prandi, A. Romanel, F. Demichelis, A. Inga, A. Cereseto, A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nat. Biotechnol. 36(3), 265-271 (2018).)) Though evoCas9 already has an impressive reduction of off-target effects, further considerations can be made such as modifications to the gRNA. There are two approaches to gRNA modification: ‘extending’ and ‘truncation.’ Extension of the gRNA involves adding two guanine nucleotides to the 5’ end of the gRNA strand. According to Congting Guo et al, these two guanine nucleotides are ‘favored in T7-promoter driven transcription, and may hinder the interaction between the Cas9/sgRNA complex and the DNA at the off-target sites.’ The significant detail here is the hindered interaction of the Cas9 and off-target effects. Meanwhile, ‘truncation’ involves removing around 2-3 nucleotides from the 5’ end, which has also been reported to improve off-target effects while maintaining on-target effects. (( C. Guo, X. Ma, F. Gao, Y. Guo, Off-target effects in CRISPR/Cas9 gene editing. Front. Bioeng. Biotechnol. 11, 1143157 (2023))
While these are the potential challenges to LNP delivery of CRISPR in the pulmonary system that have been the focal points of studies, there are other potential challenges that have very limited research. The use of inhaled LNPs to treat disease in cattle has only been lightly explored in academia. Thus, it is important for more research to go into veterinary gene editing and nanotechnology so that problems such as the rate of metabolic biodegradation of LNPs in cattle can be understood, so that LNP formulations can be made to be more effective.

Discussion
Nanoparticles for Mannheimia Haemolytica:
There are multiple steps to ensure the successful design of a nanoparticle for targeting Mannheimia haemolytica:
1. Identification of Target Biomarkers: The first step is to identify a unique biomarker on the Mannheimia haemolytica bacteria. Originally, it was thought that neuraminidase would be a suitable target as it is present on the surface of Mannheimia Haemolytica and cleaves sialic acid (which would be the receptor). However, it is unknown how well the LNPs would bind to Mannheimia Haemolytica if cleaving of sialic acid occurs. (( K. Rogers, Neuraminidase. Encyclopedia Britannica. (2024, March 6)). A suitable biomarker may be lipopolysaccharide. Lipopolysaccharide is a component of the outer membranes of gram-negative bacteria, such as Mannheimia Haemolytica (( T. Gutsmann, M. Müller, S. F. Carroll, R. C. MacKenzie, A. Wiese, U. Seydel, Dual role of lipopolysaccharide (LPS)-binding protein in neutralization of LPS and enhancement of LPS-induced activation of mononuclear cells. Infect Immun.69, 6942-6950 (2001). doi: 10.1128/IAI.69.11.6942-6950.2001.))’ (( D. McClenahan, K. Hellenbrand, D. Atapattu, N. Aulik, D. Carlton, A. Kapur, C. Czuprynski, Effects of lipopolysaccharide and Mannheimia haemolytica leukotoxin on bovine lung microvascular endothelial cells and alveolar epithelial cells. Clin Vaccine Immunol. 15, 338-347 (2008). doi: 10.1128/CVI.00344-07.)). It is composed of Lipid A, which is hydrophobic and the principle “virulence factor,” O-Antigen and a polysaccharide hydrophilic core (( A. Farhana, Y. S. Khan, Biochemistry, lipopolysaccharide. In: StatPearls [Internet]. Treasure Island (FL), StatPearlsPublishing(2025).Availablefrom: https://www.ncbi.nlm.nih.gov/books/NBK554414/)). This biomarker is desirable for multiple reasons. it is located on the outer membrane of Mannheimia Haemolytica, so receptors on lipid nanoparticles can bind externally to then go through endocytosis into the bacterium. Another desirable feature of this biomarker is that lipopolysaccharide is not present on body cells. This decreases the chance of lipid nanoparticles being absorbed by body cells and causing off-target effects. Thus, the risk of harmful mutations and cancer as a side effect are drastically reduced. Another potential binding cite on the surface of Mannheimia Haemolytica could be OmpA. OmpA is a family of proteins present in the outer membranes of gram-negative bacteria. Like lipopolysaccharide, it is exposed to the bacterium’s exterior and, thus, is a prime candidate for binding with LNP receptors. It is also not present on body cells, which decreases the risk of off-target effects. Its functions include bacterial invasion, which is beneficial as it means that OmpA proteins are, by nature of their function, more likely to interact and bind to foreign receptors. OmpA proteins are being used in vaccine research, giving precedent to their use in LNPs. (( A. W. Confer, S. Ayalew, The OmpA family of proteins: roles in bacterial pathogenesis and immunity. Vet Microbiol. 163, 207-222 (2013). doi: 10.1016/j.vetmic.2012.08.019.))
2. Selection of specific receptors/ligands: As the principle biomarker will be lipopolysaccharide, the receptor that can be used is lipopolysaccharide-binding protein (LBP). LBP is naturally found in the immune cells of cattle (( W. Schroedl, B. Fuerll, P. Reinhold, M. Krueger, C. Schuett, A novel acute phase marker in cattle: lipopolysaccharide binding protein (LBP). J Endotoxin Res. 7, 49-52 (2001). PMID: 11521082.)), and is believed to serve a dual role: low concentrations of LBP are able to activate immune cells and signal for inflammatory responses, while high concentrations can directly inhibit lipopolysaccharide-induced cell stimulation. At any concentration, however, lipopolysaccharide-binding protein is able to bind to lipopolysaccharide (( T. Gutsmann, M. Müller, S. F. Carroll, R. C. MacKenzie, A. Wiese, U. Seydel, Dual role of lipopolysaccharide (LPS)-binding protein in neutralization of LPS and enhancement of LPS-induced activation of mononuclear cells. Infect Immun.69, 6942-6950 (2001). doi: 10.1128/IAI.69.11.6942-6950.2001.)). Thus, attaching LBP to the surface of lipid nanoparticles will result in the binding of the LNPs to Mannheimia haemolytica cells, and subsequent endocytosis and CRISPR-Cas9 delivery. In addition, the presence of LBP on the LNPs may provoke a general immune and inflammatory response in the body that further weakens the infection. Due to the increased immune response, however, a greater risk is posed that immune cells may attack the foreign lipid nanoparticles. These attacks are often prompted by the presence of PEGylated lipids in the LNP, which elicit the response of anti-PEG antibodies. To mitigate the risk posed to LNPs by these antibodies, disposable and cleavable variants of “PEG-Cholesterol derivates” can be utilized instead, such as “PEG-CHMC, CHEMS, and CHST.” These variants have been proven to be effective in mitigating ‘accelerated blood clearance’ of LNPs after follow-up treatments. (( J. Wang, Y. Ding, K. Chong, M. Cui, Z. Cao, C. Tang, Z. Tian, Y. Hu, Y. Zhao, S. Jiang, Recent advances in lipid nanoparticles and their safety concerns for mRNA delivery. Vaccines (Basel). 12, 1148 (2024). doi: 10.3390/vaccines12101148.)) In terms of OmpA, the receptor C4b-binding protein can be utilized in binding interactions (( N. V. Prasadarao, A. M. Blom, B. O. Villoutreix, L. C. Linsangan, A Novel Interaction of Outer Membrane Protein A with C4b Binding Protein Mediates Serum Resistance of Escherichia coli K1. J. Immunol. 169, 6352–6360 (2002)). C4b binding protein is a complement inhibitor that “prevents uncontrolled activation of the classical and lectin complement pathways.” (( W. L. M. Werner, A. K. Criss, Diverse Functions of C4b-Binding Protein in Health and Disease. J. Immunol. 211, 1443–1449 (2023)). Its purpose is to limit the severity of the body’s immune response to prevent damage to healthy body cells. Pathogens sometimes hijack c4b binding protein in order to prevent an attack from the immune system. The use of this binding protein on LNPs has several benefits: C4b binding protein has been found to bind to OmpA proteins, meaning it can bind to Mannheimia Haemolytica’s outer membrane for subsequent endocytosis and CRISPR delivery. Because c4b binding protein regulates immune system activity, it prevents the immune cells from carrying out classical and lectin complement pathways to neutralize the LNPs. This has the benefit of increasing on-target effect as more LNPs are delivered. If Mannheimia Haemolytica cells attempt to hijack the binding protein, LNPs will enter through endocytosis and ultimately neutralize the cell regardless. A cause of concern, however, when it comes to the use of c4b binding protein is that it could lead to a slowed immune response. Research must be done to study the use of c4b binding protein on LNPs to determine safety and immune system response.
3. CRISPR-Cas9 System Design: A CRISPR-evoCas9 system is engineered to disrupt a critical bacterial gene. For this study, the gene AC571_RS03570, responsible for the regulation of DNA-templated transcription (( U.S. National Library of Medicine. Mannheimia haemolytica strain L033A Contig00008, whole genome shotgun. National Center for Biotechnology Information)) was chosen. Disruption of this gene impairs the bacterium’s ability to regulate transcription, hindering its ability to produce essential proteins and toxins, thereby neutralizing its pathogenicity.
4. Nanoparticle Synthesis: Using the microfluidics mixer, the CRISPR-evoCas9 system, along with the guide RNA (gRNA), lipids, and other essential components, is mixed to produce the final LNPs. The resulting nanoparticles are designed to be injected into livestock, where they will target and neutralize Mannheimia haemolytica, with minimal off-target effects.
5. Nanoparticle Composition:
| COMPONENT | %mol | PERCENTAGE RATIONALE | FUNCTION | |
| PEG-CHMC/PEG-CHEMS/PEG-CHST | 1.5% | 1.5%mol of PEG lipids has been found to be the most ideal %mol of PEG to have efficient LNP aerosolization. (( M. Ongun, “Lipid nanoparticles for local delivery of mRNA to the respiratory tract: Effect of PEG-lipid content and administration route,” Eur. J. Pharm. Biopharm. (2024)). | Prevents nanoparticles from clumping together and keeps the nanoparticle dissolved, Disposable PEG-Cholesterol variants protect the LNPs against antibodies and decrease the rate of accelerated blood clearance. | |
| Phospholipids | 10% | The percent composition of phospholipids has increased since original formulations as other lipids, such as ionizable cationic lipids, serve more specific and significant functions. (( A complete guide to understanding lipid nanoparticles (LNP). Inside Therapeutics. (2024). Accessed 2 Sep 2024.)) | Protects the inner layer of lipids and improves encapsulation efficiency. | |
| SM-102 (Ionizable Cationic Lipid) | 41% | The percent composition of ionizable cationic lipids is typically around 50%. However, because these LNPs are formulated to be the most efficient for aerosolization, the composition of ionizable cationic lipids must decrease as the composition of cholesterol increases. (( Let’s talk about lipid nanoparticles. Nat Rev Mater. 6, 99 (2021)) | Encapsulates the payload and enables endosomal escape. SM-102 provides most stability for aerosolization. | |
| Cholesterol | 47.5% | High concentration of cholesterol needed for stable aerosolization. Aerosolization is very desirable as it limits off-target effects, increases on-target effects and reduces clearance and accumulation of LNPs by the body. (( M. Ongun, “Lipid nanoparticles for local delivery of mRNA to the respiratory tract: Effect of PEG-lipid content and administration route,” Eur. J. Pharm. Biopharm. (2024)). | Adds structure and stability to the LNP. | |
6. Nanoparticle Bond Targeting: To ensure precise targeting, LNPs are designed to exploit the unique presence of lipopolysaccharide and OmpA proteins on the outer membrane of Mannheimia haemolytica. The nanoparticles are functionalized with LBP and C4b binding protein, which specifically binds to lipopolysaccharide and OmpA respectively and facilitate the delivery of CRISPR payload
7. Nanoparticle Size/Shape-Dependent Targeting: The nanoparticle should be of appropriate size and shape. Nanoparticles modified with PEG-lipids within the 70-100 nm range show enhanced stability and reduced aggregation, making them ideal for this application (( A. Wadhwa, T.R. Bobak, L. Bohrmann, R. Geczy, S. Sekar, G. Sathyanarayanan, J.P. Kutter, H. Franzyk, C. Foged, K. Saatchi, U.O. Häfeli, Pulmonary delivery of siRNA-loaded lipid-polymer hybrid nanoparticles: Effect of nanoparticle size. OpenNano. 13, 100180 (2023).))
8. Delivery Method: In order to decrease the rate of phospholipid-complex accumulation in the liver and decrease the rate of off-target effects on the wrong types of cells, the most ideal method of delivery would be inhalation of aerosolized particles. This delivery method also has the benefit of being an ‘in vivo’ delivery method, which is more transportable and cheaper than ‘ex vivo’ gene editing, which is significant as the issue of anti-microbial abuse is most prevalent in lower-income countries that do not have access to the appropriate facilities. However, there are considerable challenges associated with this method of delivery. Mucus clearance, which has already been discussed, can result in a majority of the phospholipid nanoparticles being cleared from the lungs before gene editing can take place. This particular problem can be alleviated through the employment of self-nano emulsification systems. There are, regardless, other problems associated with the inhalation method: It is unknown to what degree fluids present in the lungs can degrade lipid nanoparticles. It is also unclear to what degree, should the methods of preventing clearance via mucus and evasion from immune responses be too effective, a build-up of lipid nanoparticles could cause toxicity. Therefore, this review paper strongly recommends an increased emphasis on research going into the behavior of lipid nanoparticles in lung tissue. It could be beneficial to begin the experiment by exposing phospholipid complexes with CRISPR to lung tissue ex vivo and then in smaller mammals such as mice.



9. CRISPR-Cas9 Design: There is a limited amount of research looking into the use of CRISPR-systems to combat Mannheimia haemolytica infections. Thus, there have been no investigations into the efficacy of different guide-RNAs. This review article aims to create a guiding framework and recommendations for future research. For these purposes, a Mannheimia Haemolytica strain LO33A contig00008 was chosen as a sample target (the NCBI Reference Sequence is NZ_LFXZ01000008.1). And the CRISPR-Cas system was designed to target Mannheimia Haemolytica gene AC571_RS03570 which is responsible for the regulation of DNA-templated transcription. disruption of this gene through CRISPR-mediated knockout prevents the bacterium from effectively producing vital proteins and harmful toxins, rendering it non-viable. The guide RNA (gRNA) sequence designed for this purpose is UUCUCUUGCACGGCGACGUG. Using the Synthego CRISPR design tool, the gRNA was optimized to ensure high efficiency and specificity in targeting the bacterial DNA.

Using a CRISPR design tool called “Synthego,” the most optimal guide RNAs were designed that would allow the CRISPR and evoCas9 nuclease to ‘knockout’ the transcription gene.
Therefore, the CRISPR system has successfully been designed. It will include: the CRISPR system, evoCas9 nuclease, and the gRNA (UUCUCUUGCACGGCGACGUG). This guide RNA has been chosen as it presented the highest on-target score, while having zero potential off targets. Truncation and extension of the gRNA can also be done to decrease the rate of unpredicted off-target effects. This leads to the most efficient and safest gRNA strands being GGUUCUCUUGCACGGCGACGUG (extension) and CUCUUGCACGGCGACGUG (truncation). Using the nanotechnology methods described above, the CRISPR-gRNA can be use to target Mannheimia Haemolytica.
Conclusion
There are a multitude of challenges when it comes to using lipid nanoparticles and a CRISPR-Cas9 system to treat Mannheimia Haemolytica in cattle. These challenges include: the interactions of the LNPs with the pulmonary internal environment, such as mucosal clearance, immune system responses and metabolic biodegradation; the aerosolization of LNPs to provide the most effective and long-lasting impact on the pulmonary system, and to prevent accumulation in the liver, via inhalation; considering and combatting the potential for off-target effects by CRISPR-Cas9; and the formulation of lipid nanoparticles to provide stable encapsulation and the ability to bind to the Mannheimia Haemolytica pathogen. Through the review of a wide variety of studies and literature reviews, a hypothetical formulation of a lipid nanoparticle and CRISPR-Cas9 system has been created that has the potential to guide future research into treatments against Mannheimia Haemolytica. The lipid nanoparticle can be composed of:
- 1.5% PEG-CHMC/PEG-CHEMS/PEG-CHST to prevent nanoparticles from clumping together and keep the nanoparticle dissolved. Disposable PEG-Cholesterol variants protect the LNPs against antibodies and decrease the rate of accelerated blood clearance.
- 10% phospholipids to protect the inner layer of lipids and provide effective encapsulation of the CRISPR-evoCas9 payload.
- 41% SM-102 Ionizable Cationic lipids to encapsulate the payload and enable endosomal escape. SM-102 provides the most stability for aerosolization. Different ionizable cationic lipid concentrations should be investigated in order to reach a voltage of around -30mV. This will help prevent aggregation and will boost delivery efficiency.
- 47.5% cholesterol to provide structure and stability, especially to ensure stability during and post-aerosolization.
- C4b binding protein for targeting of Mannheimia Haemolytica pathogen and defense against immune system responses
- LBP for targeting of Mannheimia Haemolytica pathogen and activation of an immune system response against the infection.
- Accompanying self-nano emulsification systems to decrease clearance from the pulmonary system.
- An unknown concentration of Vitamin E can be added to the formulation to prevent oxidation and degradation of the lipid nanoparticles.
- Nanoparticles modified with PEG-lipids within the 70-100 nm range show enhanced stability and reduced aggregation, making them ideal for this application
These lipid nanoparticles can be synthesized using a thiol-ene polymer microfluidics chip, aided by a buffer solution of sodium acetate (125 mM, pH ∼5.2). The lipid nanoparticles should be stored in low-light, inert gas conditions to delay decomposition.
A synthesis of information regarding the ideal CRISPR-Cas9 system to be used has also been made. The system will include:
- The evoCas9 variant, which is a variation of spCas9 with a mutated REC3 domain that decreases off-target effects
- gRNA with the sequence GGUUCUCUUGCACGGCGACGUG (extension) or CUCUUGCACGGCGACGUG (truncation). The original gRNA strand designed using the bioinformatics software ‘Synthego’ has been extended or truncated in ways that decrease off-target effects.
By utilizing gene editing as a means of treating Mannheimia Haemolytica, the risk of the pathogen developing antimicrobial resistance genes drastically increases. This has the potential to decrease cattle mortality and morbidity across low-income countries that use harmful antimicrobial practices, thus improving the financial situation of many farmers and protecting many cattle from disease. This review paper is particularly limited to utilizing secondary data, which means it is unknown to what extent different factors and findings from diverse studies would interact well with each other in a true laboratory setting. In order for more accurate conclusions to be reached, it is important for researchers with access to proper equipment to gather more primary data, especially surrounding the topic of lipid nanoparticle aerosolization and in vivo treatment. Regardless of the review paper’s limitations, data has been gathered solely from reliable sources, a vast majority being pulled from the National Library of Medicine. This data has been decisively used in conjugation in order to reach a meaningful conclusion: that a possible pathway out of the AMR crisis is through lipid nanoparticles and gene editing. It is imperative that more research be dedicated to the subject today before the consequences of antimicrobial abuse meet the world tomorrow.





